View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0849_low_45 (Length: 251)
Name: NF0849_low_45
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0849_low_45 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 4 - 251
Target Start/End: Original strand, 40743561 - 40743806
Alignment:
Q |
4 |
ggaggagcagagaccatccttccttttagcttgatgtccattttaaaatctacagtattataatcctattttggctgtgttgatgttcaacaactagctt |
103 |
Q |
|
|
|||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40743561 |
ggaggatcagtgaccatccttcctt--agcttgatgtccattttaaaatctacagtattataatcctattttggctgtgttgatgttcaacaactagctt |
40743658 |
T |
 |
Q |
104 |
agttagatttctaagatactcacctaatgggaatttaaacattaattcagctcaatattgaccgacctattacgtaatagacaattcaactgtttttgtc |
203 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40743659 |
agttagatttctaagatactcacctaatgggaatttaaacattaattcagctcaatattgaccgacctattacgtaatagacaattcaactgtttttgtc |
40743758 |
T |
 |
Q |
204 |
ttcaactatttggagcttctcacgatctaatctagacttgatggtatt |
251 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40743759 |
ttcaactatttggagcttctcacgatctaatctagacttgatggtatt |
40743806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University