View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0849_low_47 (Length: 249)

Name: NF0849_low_47
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0849_low_47
NF0849_low_47
[»] chr8 (2 HSPs)
chr8 (99-249)||(7386507-7386655)
chr8 (68-104)||(7386768-7386804)


Alignment Details
Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 99 - 249
Target Start/End: Complemental strand, 7386655 - 7386507
Alignment:
Q  99 tttttacgtaggtttccttactttctcaaattgttttattttttaaaacataaacgtaatctttatgaaaaatgctgacccaataattcaactagaagta 198  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7386655 tttttacgtagttttccttactttctcaaattgttttattttttaaaacataaacgtaatctttatgaaaaatgctgacccaataattcaactagaagta 7386556  T
Q  199 tataatctaataaatattttggttttgtttttaaaaacaaaccgtggaact 249  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||    
T  7386555 tataatctaataaatattttgg--ttgtttttaaaaacaaaccgtggaact 7386507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 104
Target Start/End: Complemental strand, 7386804 - 7386768
Alignment:
Q  68 ttatttggttctgatattcatatgaactaacttttta 104  Q
    |||||||||||| ||||||||||||||| ||||||||    
T  7386804 ttatttggttctaatattcatatgaactcacttttta 7386768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3067 times since January 2019
Visitors: 6169