View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0849_low_8 (Length: 424)
Name: NF0849_low_8
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0849_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 29 - 362
Target Start/End: Complemental strand, 50421240 - 50420902
Alignment:
Q |
29 |
aaatcatgtatacatctaaaaacaagtatgttggattaaacgattaaggtttatgcgaggaaacctctcagccgatggaaggttatgagaaggctaaaac |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50421240 |
aaatcatgtatacatctaaaaacaagtatgttggat-aaacgattaaggtttatgcgaggaaacctctcagccgatggaaggttatgagaaggctaaaac |
50421142 |
T |
 |
Q |
129 |
aaccaagtgtgaaaattggannnnnnnn-ctcaagtctagtgattgattacgtgggtatcagagatctcaaaccgagtcaaaactt-----gacaacaca |
222 |
Q |
|
|
|||| ||||||||||||||| |||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
T |
50421141 |
aaccgagtgtgaaaattggatttttttttctcaggtctagtgactgattacgtgggtatcaaagatctcaaaccgagtcaaaacttaataggacaacaca |
50421042 |
T |
 |
Q |
223 |
atgatgcttgaaactcacgcaccacattcatactaaacacaagacggtgaaagaggaattacgtttgcgggggagctgtgtatccaagaccttgtcaaaa |
322 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
T |
50421041 |
atgatgcttgaaactcacgcaccacattcatactaaacacaagacggtgaaagaggaattacgtttgcgggggagctgtgtaccgaagaccttgtcaaaa |
50420942 |
T |
 |
Q |
323 |
tttaaaggcttaatagcaattttggcctcctgagtattat |
362 |
Q |
|
|
|||||||||||||||||| |||||||||||| |||||||| |
|
|
T |
50420941 |
tttaaaggcttaatagcagttttggcctcctaagtattat |
50420902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University