View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0850_high_3 (Length: 294)
Name: NF0850_high_3
Description: NF0850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0850_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 104 - 284
Target Start/End: Complemental strand, 9389257 - 9389077
Alignment:
Q |
104 |
aattttcctagttctaatcataaaccaattttattccaattgaataatagtacaataatttggttataacactttcttttgtttcatcttattaagcata |
203 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9389257 |
aattttcctagttttaatcataaaccaattttattccaattgaataatagtacaataatttggttataacactttcttttgtttcatcttattaagcata |
9389158 |
T |
 |
Q |
204 |
aactttgttttacacatcgacttccatgagatgatgagttgtacatgtgctccatgaccacgagaacaagttttgtctctg |
284 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
9389157 |
aactttgttttacacatcgacttccatgagatgatgagttgtacatgtgctccatgaccatgagaacaagttttgtctctg |
9389077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University