View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0850_low_10 (Length: 247)
Name: NF0850_low_10
Description: NF0850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0850_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 39930373 - 39930465
Alignment:
| Q |
1 |
ctgaagcaacatagaaagtgaagaagtaccagttgaaaaatgttccttgatgttctggtttgtcaaattgatttgcacctaatgatgctgctg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39930373 |
ctgaagcaacatagaaagtgaagaagtaccagttgaaaaatgttccttgatgttctggtttgtcaaattgatttgcacctaatgatgctgctg |
39930465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 3 - 93
Target Start/End: Complemental strand, 39702924 - 39702834
Alignment:
| Q |
3 |
gaagcaacatagaaagtgaagaagtaccagttgaaaaatgttccttgatgttctggtttgtcaaattgatttgcacctaatgatgctgctg |
93 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||| ||| |||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
39702924 |
gaagcaacatagaaagtgaaaaagaaccagttgaaaaatgttccttgatcttcaagtttgtcaaactgatttgcacctagtgatgctgctg |
39702834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 39692953 - 39692861
Alignment:
| Q |
1 |
ctgaagcaacatagaaagtgaagaagtaccagttgaaaaatgttccttgatgttctggtttgtcaaattgatttgcacctaatgatgctgctg |
93 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||||||||||||| |||| |||||||||||||||| ||||||||| || |||| ||||||||||| |
|
|
| T |
39692953 |
ctgaagcaacatagaaagcgaaaaagaaccagttgaaaaatattccctgatgttctggtttgttaaattgattggctcctagtgatgctgctg |
39692861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2177 times since January 2019
Visitors: 6159