View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0850_low_11 (Length: 240)
Name: NF0850_low_11
Description: NF0850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0850_low_11 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 10 - 240
Target Start/End: Complemental strand, 9969797 - 9969567
Alignment:
| Q |
10 |
atggcataaaata-tttttaaaagagtctagcggcagctaactcgatgaggaaaagaggagcatttcagggttcgagtctgcgaccccaacactcttata |
108 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9969797 |
atggcataaaatactttttaaaagagtctagcggaagcgaactcgatgaggaaaagaggaacatttcagggttcgagtctgcgaccccaacactctaata |
9969698 |
T |
|
| Q |
109 |
accccgagatagaaatattctcttaaattctttgtgcattgaatttttcaaaagtttaaaaactatttattttcgaacacaatttcttttgtttaggtca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9969697 |
accccgagatagaaatattctcttaaattctttgtgcattgaatttttcaaaagtttaaaaactatttattttcgaacacaatttcttttgtttaggtta |
9969598 |
T |
|
| Q |
209 |
cttaacatatatcctaagacgtacattagtaa |
240 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||| |
|
|
| T |
9969597 |
cttaacatataccctaa-acgtaaattagtaa |
9969567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2983 times since January 2019
Visitors: 6168