View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0850_low_3 (Length: 362)
Name: NF0850_low_3
Description: NF0850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0850_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 101 - 228
Target Start/End: Complemental strand, 10980470 - 10980343
Alignment:
| Q |
101 |
agtatttgctagaaaattcaaagggtggacactgtgatgaagaagccatgaaggaaattaaagaactatttttgatttagttatttgatgttatttatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10980470 |
agtatttgctagaaaattcaaagggtggacactgtgatgaagaagccatgaaggaaattaaagaactatttttgatttagttatttgatgttatttatca |
10980371 |
T |
|
| Q |
201 |
tcattcaatgaaactataatacctatgc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
10980370 |
tcattcaatgaaactataatacctatgc |
10980343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1045 times since January 2019
Visitors: 6135