View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0850_low_4 (Length: 316)
Name: NF0850_low_4
Description: NF0850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0850_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 94 - 266
Target Start/End: Complemental strand, 33338007 - 33337833
Alignment:
Q |
94 |
atctagtcaatcaagtcaaaggaaaaagatatttgtagagactccctnnnnnnnn-gatatttaaagagatattttatgaactaagttaaaaatgtggtg |
192 |
Q |
|
|
||||| |||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33338007 |
atctattcaatcaaatcaaaggaaaaagatatttgtagagactccctaaaaaaaaagatatttaaagagatattttatgaactaagttaaaaatgtggtg |
33337908 |
T |
 |
Q |
193 |
ttgtaaaataatttgatttggtgcatatgtaaaaaagttttacaacgt-tgtgatacaaattaaacaagtataat |
266 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
33337907 |
ttgtaaaataatttgatttggtgcatatgtaaaaaagttttacaacgtctgtgatacaaattaaacaagtataat |
33337833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 894 times since January 2019
Visitors: 6134