View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0850_low_9 (Length: 258)
Name: NF0850_low_9
Description: NF0850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0850_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 20 - 225
Target Start/End: Complemental strand, 54166825 - 54166620
Alignment:
Q |
20 |
aatatatggaagatgaacacgtatgtatggatgatcttactcaacacataggttctgcttcaaatgttccttttcctggagctttctatggggttcgtat |
119 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54166825 |
aatatatggaagatgaacacgtacgtatggatgatcttactcaacacataggttctgcttcaaatgttccttttcctggagctttctatggggttcgtat |
54166726 |
T |
 |
Q |
120 |
gttattcttactcgagattacagtttatatacatttgctatgatataaagcttcatatttacattcacatgttgaacctgttagataacaatggattgaa |
219 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54166725 |
gttattcttactcgagattacagtttatatacatttgctatgatataaagcttcatatttacattcacatgttgaacctgttagataacaatggattgaa |
54166626 |
T |
 |
Q |
220 |
gtttgt |
225 |
Q |
|
|
||||| |
|
|
T |
54166625 |
atttgt |
54166620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University