View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0851-INSERTION-5 (Length: 219)
Name: NF0851-INSERTION-5
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0851-INSERTION-5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 7 - 187
Target Start/End: Complemental strand, 4129877 - 4129697
Alignment:
| Q |
7 |
gtgtcttgctacaaaagtgccgtatcattcacatataaccctgctgcagcaacatttggtcatgagaaaatggtatggggtcattctataccaaatgatc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4129877 |
gtgtcttgctacaaaagtgccgtatcattcacatataaccctgctgcagcaacatttggtcatgagaaaatggtatggggtcattctatatcaaatgatc |
4129778 |
T |
|
| Q |
107 |
tcataaattggactcatctaaatgatgctattgtaccaactatacctggtgacataaacagttgttggtcaggttcagcca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4129777 |
tcataaattggactcatctaaatgatgctattgtaccaactatacctggtgacataaacagttgttggtcaggttcagcca |
4129697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 39 - 187
Target Start/End: Complemental strand, 4138561 - 4138413
Alignment:
| Q |
39 |
atataaccctgctgcagcaacatttggtcatgagaaaatggtatggggtcattctataccaaatgatctcataaattggactcatctaaatgatgctatt |
138 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4138561 |
atataaccctgatgcagcaacatttggtcatgagaaaatggtatggggtcattctatatcaaatgatctcataaattggactcatctaaatgatgctatt |
4138462 |
T |
|
| Q |
139 |
gtaccaactatacctggtgacataaacagttgttggtcaggttcagcca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4138461 |
gtaccaactatacctggtgacataaacagttgttggtcaggttcagcca |
4138413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 73 - 147
Target Start/End: Complemental strand, 4143273 - 4143199
Alignment:
| Q |
73 |
aaaatggtatggggtcattctataccaaatgatctcataaattggactcatctaaatgatgctattgtaccaact |
147 |
Q |
| |
|
|||||||||||||||||||| ||| | || ||||||||||||||||||||| | ||| ||||||||| ||||||| |
|
|
| T |
4143273 |
aaaatggtatggggtcattcaatatccaaagatctcataaattggactcatttgaatcatgctattgaaccaact |
4143199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 185
Target Start/End: Complemental strand, 4118638 - 4118507
Alignment:
| Q |
51 |
tgcagcaacatttggtcatgagaaaatggtatggggtcattctataccaaatgatctcataaattggactcatctaaatgatgctattgtaccaactata |
150 |
Q |
| |
|
|||||||||||||||| || | ||| ||||||| ||||||| || | |||||||||| ||||||| |||||| || |||| ||| ||||| | | |
|
|
| T |
4118638 |
tgcagcaacatttggtgat---ataattgtatgggctcattctgtatcctatgatctcattaattggattcatctcaacattgctcttgaaccaagtgga |
4118542 |
T |
|
| Q |
151 |
cctggtgacataaacagttgttggtcaggttcagc |
185 |
Q |
| |
|
||| |||||| || |||||||||||||||||||| |
|
|
| T |
4118541 |
ccttatgacatcaatagttgttggtcaggttcagc |
4118507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 167 times since January 2019
Visitors: 6125