View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0851-INSERTION-8 (Length: 245)
Name: NF0851-INSERTION-8
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0851-INSERTION-8 |
 |  |
|
[»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 214 - 245
Target Start/End: Original strand, 12750000 - 12750031
Alignment:
Q |
214 |
cctgagaactactctatcacacatgacaaatg |
245 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
12750000 |
cctgagaactactctatcacacatgacaaatg |
12750031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 214 - 245
Target Start/End: Original strand, 12813113 - 12813144
Alignment:
Q |
214 |
cctgagaactactctatcacacatgacaaatg |
245 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
12813113 |
cctgagaactactctatcacacatgacaaatg |
12813144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 142 times since January 2019
Visitors: 6125