View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0851_high_29 (Length: 221)

Name: NF0851_high_29
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0851_high_29
NF0851_high_29
[»] chr1 (1 HSPs)
chr1 (31-147)||(33237381-33237497)


Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 31 - 147
Target Start/End: Complemental strand, 33237497 - 33237381
Alignment:
31 aagaaactaaaatagaacgaaaaataaacttaacggacctaggtgtcttacatttataacttaaggaaccaaaatggaacgaaaagaagatatataactt 130  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33237497 aagaaactaaaatagaacgaaaaataaacttaacggacctaggtgtcttacatttataacttaaggaaccaaaatggaacgaaaagaagatatataactt 33237398  T
131 acgatacacctatgata 147  Q
    |||||||||| ||||||    
33237397 acgatacaccaatgata 33237381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University