View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0851_low_16 (Length: 393)

Name: NF0851_low_16
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0851_low_16
NF0851_low_16
[»] chr3 (2 HSPs)
chr3 (78-200)||(52592866-52592988)
chr3 (268-296)||(52592772-52592800)


Alignment Details
Target: chr3 (Bit Score: 115; Significance: 3e-58; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 78 - 200
Target Start/End: Complemental strand, 52592988 - 52592866
Alignment:
78 aatatcaaaaacccggatttgaataaatgataaccaaacagggaacaatccattatacaaataaattatgttcttatatgcttgaaatgctttgtttttt 177  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||    
52592988 aatatcaaaaacccggatttgaataaatgataaccaaacagggaacaatccattatacaaataaattctgttcttacatgcttgaaatgctttgtttttt 52592889  T
178 atggttgaaattacactggtcac 200  Q
    |||||||||||||||||||||||    
52592888 atggttgaaattacactggtcac 52592866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 268 - 296
Target Start/End: Complemental strand, 52592800 - 52592772
Alignment:
268 taatagcccaatatagtctataaactaat 296  Q
    |||||||||||||||||||||||||||||    
52592800 taatagcccaatatagtctataaactaat 52592772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3304 times since January 2019
Visitors: 6172