View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0851_low_25 (Length: 343)
Name: NF0851_low_25
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0851_low_25 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 5e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 4 - 211
Target Start/End: Complemental strand, 18587808 - 18587597
Alignment:
| Q |
4 |
gtatttgtttatcattttgaattttgtaagttttgtgaatggaggcttttgtaagtgatgtgtatatttacctttacataatagatgatttgaattattc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18587808 |
gtatttgtttatcattttgaattttgtaagttttgtgaatggaggcttttgtaagtgatgt--atatttacctttacataatagatgatttgaattattc |
18587711 |
T |
|
| Q |
104 |
cttttttaggctgaaataatatttctttctattatatatactttttaaacct------tagttgtattcttcatcgtgtttaatgaagatgggtgtgttg |
197 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||||||||| | || ||||||||||| |||||| |
|
|
| T |
18587710 |
cttttttgggctgaaataatatttctttctattatatatgctttttaagccttaattgtagttgtattcttcatctagattgatgaagatgggcgtgttg |
18587611 |
T |
|
| Q |
198 |
gtgttgatatgatg |
211 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
18587610 |
gtgttgatatgatg |
18587597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 343
Target Start/End: Original strand, 52592934 - 52592966
Alignment:
| Q |
311 |
taatggattgttccctgtttggttatcatttat |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
52592934 |
taatggattgttccctgtttggttatcatttat |
52592966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1964 times since January 2019
Visitors: 6152