View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0851_low_38 (Length: 268)
Name: NF0851_low_38
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0851_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 106 - 230
Target Start/End: Original strand, 40731190 - 40731317
Alignment:
Q |
106 |
ttgtacttgaaaattgaaataaggatgctattgccaatttaaggtatt---tttaaacttatggaatggtagctttttgtctctttatggtgacatacta |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40731190 |
ttgtacttgaaaattgaaataaggatgctattgccaatttaaggtattgtttttaaacttatggaatggtagctttttgtctctttatggtgacatacta |
40731289 |
T |
 |
Q |
203 |
gcatgttttagatggtgcatactattac |
230 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
40731290 |
gcatgttttagatggtgcatactattac |
40731317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University