View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0851_low_38 (Length: 268)

Name: NF0851_low_38
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0851_low_38
NF0851_low_38
[»] chr7 (1 HSPs)
chr7 (106-230)||(40731190-40731317)


Alignment Details
Target: chr7 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 106 - 230
Target Start/End: Original strand, 40731190 - 40731317
Alignment:
106 ttgtacttgaaaattgaaataaggatgctattgccaatttaaggtatt---tttaaacttatggaatggtagctttttgtctctttatggtgacatacta 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||    
40731190 ttgtacttgaaaattgaaataaggatgctattgccaatttaaggtattgtttttaaacttatggaatggtagctttttgtctctttatggtgacatacta 40731289  T
203 gcatgttttagatggtgcatactattac 230  Q
    ||||||||||||||||||||||||||||    
40731290 gcatgttttagatggtgcatactattac 40731317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3772 times since January 2019
Visitors: 6175