View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0851_low_4 (Length: 552)
Name: NF0851_low_4
Description: NF0851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0851_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 2e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 360 - 545
Target Start/End: Original strand, 13861193 - 13861375
Alignment:
| Q |
360 |
gttgtgattatataaatatttctcttcctctnnnnnnnntcagtatttctcttattttgtttactcacact-agtcgtaatagaaattatattgctcata |
458 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13861193 |
gttgtgattatataaatatttctcttcctctaaaaaaa-tcagtatttctcgtattttgtttactcacacttagtcgtaatagaaattatattgctcata |
13861291 |
T |
|
| Q |
459 |
tgctcgctaaacatgctatttttaactcagaggaggtgtgtattgaagaacccacacattttctataatctctgctgatattcttgg |
545 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13861292 |
tgctcgctaaacatgctatttttaaccca---gaggtgtgtattgaagaacccacacattttctataatctctgctgattttcttgg |
13861375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 108; E-Value: 6e-54
Query Start/End: Original strand, 30 - 229
Target Start/End: Original strand, 13860862 - 13861061
Alignment:
| Q |
30 |
aggtttttgcttcgcatcccaaatttgttgtattgattgcatccttgagcttgattgtgaaccaacttgcttaggaatgtnnnnnnnnnnnnnnnnnnnn |
129 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13860862 |
aggttttcgcttcgcatcccaaatttgttgtattgattgcatccttgagcttgattgtgaaccaacttgcttagaaatgtagaaaagaaagaaagaaaaa |
13860961 |
T |
|
| Q |
130 |
nnnncatttcgtagaaatatctctcattcttgaaaattgttggaaaaagttgagtttagctttagatttctcttgtgagatatacttgtttgatcacaag |
229 |
Q |
| |
|
| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13860962 |
aagacctttcgtagaaatatctctcattcttgaacattgttggaaaaagttgagtttagctttagatttctcttgtgagatatacttgtttcatcacaag |
13861061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1245 times since January 2019
Visitors: 6138