View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0852_high_31 (Length: 244)

Name: NF0852_high_31
Description: NF0852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0852_high_31
NF0852_high_31
[»] chr8 (1 HSPs)
chr8 (178-223)||(473267-473312)
[»] chr7 (1 HSPs)
chr7 (178-223)||(41521299-41521344)


Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 178 - 223
Target Start/End: Original strand, 473267 - 473312
Alignment:
178 caatttcgatgagagttgttgggaagtagtaaaatagttcaagggt 223  Q
    |||||| |||||||||||||||||| ||||||||||||||||||||    
473267 caatttagatgagagttgttgggaattagtaaaatagttcaagggt 473312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 178 - 223
Target Start/End: Complemental strand, 41521344 - 41521299
Alignment:
178 caatttcgatgagagttgttgggaagtagtaaaatagttcaagggt 223  Q
    |||||| ||||||| |||||||||||||||||||||||||||||||    
41521344 caatttagatgagacttgttgggaagtagtaaaatagttcaagggt 41521299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University