View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0852_high_31 (Length: 244)
Name: NF0852_high_31
Description: NF0852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0852_high_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 178 - 223
Target Start/End: Original strand, 473267 - 473312
Alignment:
| Q |
178 |
caatttcgatgagagttgttgggaagtagtaaaatagttcaagggt |
223 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
473267 |
caatttagatgagagttgttgggaattagtaaaatagttcaagggt |
473312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 178 - 223
Target Start/End: Complemental strand, 41521344 - 41521299
Alignment:
| Q |
178 |
caatttcgatgagagttgttgggaagtagtaaaatagttcaagggt |
223 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41521344 |
caatttagatgagacttgttgggaagtagtaaaatagttcaagggt |
41521299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University