View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0852_low_14 (Length: 454)
Name: NF0852_low_14
Description: NF0852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0852_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 43 - 348
Target Start/End: Original strand, 50532364 - 50532669
Alignment:
| Q |
43 |
aataaaccctcaatttcgtccctgaactattactctttgttcaaattgttccctaaattattaaaacttattaaaaatccatgacttattcccatccatc |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50532364 |
aataaaccctcaatttcgtccctgaactattactctttgttcaaattgttccctaaattattaaaacttattaaaaatccatgacttattcccatccatc |
50532463 |
T |
|
| Q |
143 |
tccgtcaaattagtacctactggttaatgttgtatgattctgatttaccagtttaatgaattctagttttctggtttaatgttatatgaattctgatttg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50532464 |
tccgtcaaattagtacctactggttaatgttgtatgattctgatttaccagtttaatgaattatagttttctggtttaatgttatatgaattctgatttg |
50532563 |
T |
|
| Q |
243 |
cataaggttttgttgttgaattaagcactactgcaagcagctagaatcaaccgtgagtggttgagctcccactcatgcaccatgttcccatactcgtgat |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50532564 |
cataaggttttgttgttgaattaagcactactgcaagcagctagaatcaaccgtgagtggttgagctcccactcatgcaccatgttcccatactcgtgat |
50532663 |
T |
|
| Q |
343 |
tttcat |
348 |
Q |
| |
|
|||||| |
|
|
| T |
50532664 |
tttcat |
50532669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1590 times since January 2019
Visitors: 6145