View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0852_low_28 (Length: 329)
Name: NF0852_low_28
Description: NF0852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0852_low_28 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 124 - 329
Target Start/End: Original strand, 11759010 - 11759210
Alignment:
| Q |
124 |
cattgttcaattgctttgatatggttttgttaattaagacattgaaacagtgacatggttggaaatggaatggagaattgaaacagagttaggctttgcg |
223 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11759010 |
cattgtttaattgctttgatatggttttgttaattaagaaattgaaacagtgacatggttggaaatg-----gagaattgaaacagagttaggctttgcg |
11759104 |
T |
 |
| Q |
224 |
tttgaatgtagttgttatttttatttatttgttattacttaattaaaagctagtagttcgttattaagtagtgttgcatgtgagagagcacgcttgaaga |
323 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11759105 |
tttgaatgtagtagttatttttatttatttgttattacttaattaaaagctagtagttcgttattaagtagtgttgcatgtgagagagcacgcttgaaga |
11759204 |
T |
 |
| Q |
324 |
gtgtga |
329 |
Q |
| |
|
|||||| |
|
|
| T |
11759205 |
gtgtga |
11759210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University