View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0852_low_30 (Length: 322)
Name: NF0852_low_30
Description: NF0852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0852_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 12322730 - 12322458
Alignment:
Q |
1 |
gtaatgtgaccacaaactgaaaatgaagactttctttcttagttcttgaaatttctgcagaatcttcttatagctgcatgtgaaaatattgcctaagaat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12322730 |
gtaatgtgaccacaaactgaaaatgaagactttctttcttagttcttgaaatttctgcagaatcttcttatagctgcatgtgaaaatattgcctaagaat |
12322631 |
T |
 |
Q |
101 |
tgaaactatgaccatactatacgtaacaatgaaccactaataacatgtcacgtgttatagcttataatcacaaacacttttgtcacctcagaacacnnnn |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12322630 |
tgaaactatgaccatactatacgtaacaatgaaccactaataacatgtcacgtgttatagcttataatcacaaacacttttgtcacctcagaacacaaaa |
12322531 |
T |
 |
Q |
201 |
nnngtgcactcacgaatctctctagtcacttaattggttttgttgtttatgaagtttctttctctgttctttc |
273 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12322530 |
aaagtgcactcacgaatctctctagtcacttaattggttttgttgtttatgaagtttctttctctgttctttc |
12322458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University