View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0852_low_34 (Length: 269)
Name: NF0852_low_34
Description: NF0852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0852_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 29 - 260
Target Start/End: Complemental strand, 37046466 - 37046236
Alignment:
| Q |
29 |
aatataaactgtcgtgtcacgatatttgatattattataaattgctaacaaatgtatgtaattgattgatgtgacttaatcaatagttgtggcgacatca |
128 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37046466 |
aatataaactctcgcgtcacgatatttgatattattataaattgctaacaaatgtatgtaattgattgatgtgatttaatcaatagttgtggcgacatca |
37046367 |
T |
 |
| Q |
129 |
agattgacatcaagaatcttgatgtcgcagtttatatgtcgcggtttaagcannnnnnnnattacattgacattgattttgtattgcaattctattgtgt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37046366 |
agattgacatcaagaatcttgatgtcgcagtttatatgtcgcggtttaagca-tttttttattacattgacattgattttgtattgcaattctattgtgt |
37046268 |
T |
 |
| Q |
229 |
tatttaaacaatttaatctagacaatattctt |
260 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
37046267 |
tatttaaacaatttaatctagacaattttctt |
37046236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 68
Target Start/End: Complemental strand, 37036762 - 37036722
Alignment:
| Q |
28 |
caatataaactgtcgtgtcacgatatttgatattattataa |
68 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||| |||||| |
|
|
| T |
37036762 |
caatataaactctcgcgtcacgatatttgatattcttataa |
37036722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University