View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0854_high_31 (Length: 251)
Name: NF0854_high_31
Description: NF0854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0854_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 12 - 139
Target Start/End: Original strand, 31366043 - 31366170
Alignment:
| Q |
12 |
agagagtagagtaataaagaaatgatgttgtgatatatttaaatagtgagatttaattgaatatgtcagtaaaataaaatgacaatgttttttgaaagag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31366043 |
agagagtagagtaataaagaaatgatgttgtgatatatttaaatagtgagatttaattgaatatgtcagtaaaataaaatgacaatgttttttgaaagag |
31366142 |
T |
 |
| Q |
112 |
aataaaattacaatattgacgatgatga |
139 |
Q |
| |
|
|||||||||||||| ||||||||||||| |
|
|
| T |
31366143 |
aataaaattacaatgttgacgatgatga |
31366170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University