View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0854_high_31 (Length: 251)

Name: NF0854_high_31
Description: NF0854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0854_high_31
NF0854_high_31
[»] chr4 (1 HSPs)
chr4 (12-139)||(31366043-31366170)


Alignment Details
Target: chr4 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 12 - 139
Target Start/End: Original strand, 31366043 - 31366170
Alignment:
12 agagagtagagtaataaagaaatgatgttgtgatatatttaaatagtgagatttaattgaatatgtcagtaaaataaaatgacaatgttttttgaaagag 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31366043 agagagtagagtaataaagaaatgatgttgtgatatatttaaatagtgagatttaattgaatatgtcagtaaaataaaatgacaatgttttttgaaagag 31366142  T
112 aataaaattacaatattgacgatgatga 139  Q
    |||||||||||||| |||||||||||||    
31366143 aataaaattacaatgttgacgatgatga 31366170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1970 times since January 2019
Visitors: 6152