View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0854_high_45 (Length: 218)
Name: NF0854_high_45
Description: NF0854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0854_high_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 216
Target Start/End: Original strand, 35029537 - 35029735
Alignment:
| Q |
18 |
acactccgtaaagtaagttgcccaattaccattataatatactccacttaagtaacactccaactcttcaaggcattccatacccacggccataagaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35029537 |
acactccgtaaagtaagttgcccaattaccattataatatactccacttaagtaacactccaactcttcaaggcattccatacccacggccataagaaaa |
35029636 |
T |
|
| Q |
118 |
caaccnnnnnnnnnttgtcttcaaaatgaatggtatgaaaagtatacaacttttcacaacccaaatttaaaagtttgctagccagctagcttagatttt |
216 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35029637 |
caaccaaaaaatatttgtcttcaaaatgaatggtatgaaaagtatacaacttttcacaacccaaatttaaaagtttgctagccagctagcttagatttt |
35029735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3619 times since January 2019
Visitors: 6174