View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0854_low_17 (Length: 414)

Name: NF0854_low_17
Description: NF0854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0854_low_17
NF0854_low_17
[»] chr4 (1 HSPs)
chr4 (324-386)||(24319684-24319746)


Alignment Details
Target: chr4 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 324 - 386
Target Start/End: Original strand, 24319684 - 24319746
Alignment:
324 gtctataaatgccctgaaaacatccattctttttaagcacacactctatcaagtgggaaaaat 386  Q
    |||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||||    
24319684 gtctataaatgcccagaaaacatccattctttttaagcacacactcaatcaagtggaaaaaat 24319746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University