View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0854_low_17 (Length: 414)
Name: NF0854_low_17
Description: NF0854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0854_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 324 - 386
Target Start/End: Original strand, 24319684 - 24319746
Alignment:
Q |
324 |
gtctataaatgccctgaaaacatccattctttttaagcacacactctatcaagtgggaaaaat |
386 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
T |
24319684 |
gtctataaatgcccagaaaacatccattctttttaagcacacactcaatcaagtggaaaaaat |
24319746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University