View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0854_low_23 (Length: 367)
Name: NF0854_low_23
Description: NF0854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0854_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 4e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 23 - 271
Target Start/End: Original strand, 52794124 - 52794369
Alignment:
Q |
23 |
gagatgaaatacgatttgtttttagaaacaannnnnnnatcggtatttatagaaatgatttgattttgttgatgaatcaaacgcgtggtaattaatggct |
122 |
Q |
|
|
||||||||||||||||||||| ||||||||| |||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
52794124 |
gagatgaaatacgatttgtttatagaaacaatttttttatcggtatttctagaaaggatttgattttgttgatgaatcaaacgcgtggtaata---ggct |
52794220 |
T |
 |
Q |
123 |
tacttgtacaataccattttatatgtggtactttactgattattgaatgatttgcttaaattagagatgcagtaccattcnnnnnnnnggaaatgaattg |
222 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
52794221 |
tacttgtgcaataccattttatatgtggtactttactgattattgaatgatttgcttaaattagagatgcagtaccattctttttattggaaatgaattg |
52794320 |
T |
 |
Q |
223 |
attttgttcataatacaaacgcgtccgattttgcattcactgcatacat |
271 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52794321 |
attttgttcataatacaaacgcgtccgattttgcattcactgcatacat |
52794369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 552 times since January 2019
Visitors: 6130