View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0854_low_26 (Length: 355)
Name: NF0854_low_26
Description: NF0854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0854_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 49 - 279
Target Start/End: Complemental strand, 10693452 - 10693222
Alignment:
| Q |
49 |
gaatgttacgtgtattataaatagtggaattaccaaaggtatctagttattgaaaaatagcatatttcgattgatttattgaagaatagttattgacata |
148 |
Q |
| |
|
|||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10693452 |
gaatgttatgtatattataaataatggaattaccaaaggtatctagttattgaaaaatagcatatttcgattgatttattgaagaatagttattgacata |
10693353 |
T |
|
| Q |
149 |
agtaattattgaattgtttgaaagagcatatgnnnnnnncttatgatatgtttgtaacttattttcaggtaatctctatagggtaacttatgaaaacaat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10693352 |
agtaattattgaattgtttgaaagagcatatgaaaacaacttatgatatgtttgtaacttattttcaggtaatctctatagggtaacttatgaaaacaat |
10693253 |
T |
|
| Q |
249 |
ttatagtttatagtttgtatgcaaacatttt |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10693252 |
ttatagtttatagtttgtatgcaaacatttt |
10693222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 304 - 345
Target Start/End: Complemental strand, 10693191 - 10693150
Alignment:
| Q |
304 |
gtaatagaaatagtttatacaagaaaatgatacgtacctatg |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10693191 |
gtaatagaaatagtttatacaagaaaatgatacgtacctatg |
10693150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 426 times since January 2019
Visitors: 6128