View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0854_low_27 (Length: 348)
Name: NF0854_low_27
Description: NF0854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0854_low_27 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 60 - 348
Target Start/End: Complemental strand, 24868365 - 24868077
Alignment:
| Q |
60 |
tgtccctctttctggcacaatcgacatttgtatactctctgagatgtcatatccattcttttatttgaaataacttgagggcatgttcttcggttatggc |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24868365 |
tgtccctctttctggcacaatcgacatttgtatactctctgagatgtcatatccattcttttatttgaaataacttgagggcatgttcttcggttatggc |
24868266 |
T |
 |
| Q |
160 |
catattgtcgacatattttacatcgatgatgttttataactctcccatcactatggcttatccttaacttactgcatgttcttctgttgtgtcctttttc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24868265 |
catattgtcgacatattttacatcgatgatgttttataactctcccatcactatggcttatccttaacttactgcatgttcttctgttgtggcctttttc |
24868166 |
T |
 |
| Q |
260 |
accacatagtctacatgtgaatcgccgatcaatcaaaccgtccttcagttctggacagtagtgtctcctatgtccttcacgtccacagt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24868165 |
gccacatagtctacatgtgaatcgccgatcaatcaaaccatcctttagttctggacagtagtgtctcctatgtccttcacgtccacagt |
24868077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University