View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0854_low_31 (Length: 325)
Name: NF0854_low_31
Description: NF0854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0854_low_31 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 33 - 325
Target Start/End: Original strand, 2151780 - 2152072
Alignment:
| Q |
33 |
tcactagcttattaaaacattttacaatttatatgaaaatattctcttgcttctagaatatatagacattttctgagcttatagagacatgataagtgct |
132 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||| | |||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2151780 |
tcactagcttattgaaacattttacaatttagatgaaaatattattttgcttgtagaatatatcgacattttctgagcttatagagacatgataagtgct |
2151879 |
T |
|
| Q |
133 |
taacttaactgtgtataaaccttaatttgatcgagcataataacatcttaatgcaggttaatagctcacctaagttgataatcactggacttgctcttgg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2151880 |
taacttaactgtgtataaaccttaatttgatcaagcataataacatcttaatgcaggttaatagctcacctaagttgataatcactggacttgctcttgg |
2151979 |
T |
|
| Q |
233 |
aggatcaattgcttcactcttcactttattactattagatggatttgactcaagaaagaaaaaacctctttgcattacctttgctactccact |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
2151980 |
aggatcaattgcttcactcttcactttattactattagatggatttgactcaagaaagaaaaaacctctttgcattacctttggttctccact |
2152072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 272
Target Start/End: Original strand, 2205858 - 2205903
Alignment:
| Q |
227 |
tcttggaggatcaattgcttcactcttcactttattactattagat |
272 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| |||||||||| |
|
|
| T |
2205858 |
tcttggaggatcaatagcttcactcttcacaatatcactattagat |
2205903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 961 times since January 2019
Visitors: 6135