View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0854_low_41 (Length: 278)
Name: NF0854_low_41
Description: NF0854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0854_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 40 - 229
Target Start/End: Complemental strand, 25788621 - 25788431
Alignment:
| Q |
40 |
aagaagcttacaacagatatttcatctttggaaaggatgaaaggccatcatgattttcattgaaagttatatcaactgacaaattgttgtatgagaggcc |
139 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25788621 |
aagaagctaacaacagatatttcatctttggaaaggatgaaaggccatcatgattttcattgaaagttatatcaactgacaaattgttgtatgagaggcc |
25788522 |
T |
|
| Q |
140 |
taatgtatttaaactctgcagtttctgaatcatgtcaagccgcattgtgccattggtcaagccgcatcc-cacaaattattgtgcaacagc |
229 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
25788521 |
taatgtatttaaactctgcagcctctgaatcatgtcaagccgcattgtgccattgttcaagccgcatcctgtcaaattattgtgcaacagc |
25788431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 642 times since January 2019
Visitors: 6130