View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0854_low_46 (Length: 263)
Name: NF0854_low_46
Description: NF0854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0854_low_46 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 10 - 263
Target Start/End: Original strand, 2745400 - 2745653
Alignment:
Q |
10 |
attattctctgttgtcttcagtcaaatggcatcactctttgtggaacaaggtgctgcaatggagactaaaatttccacttttcacatccctcctgcaagt |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2745400 |
attattctctgttgtcttcagtcaaatggcatcactctttgtggaacaaggtgctgcaatggagactaaaatttccacttttcacatccctcctgcaagt |
2745499 |
T |
 |
Q |
110 |
atgtcaagctttgacattctcagtgtagtttctttcatcttcatctatcggagaattctcgaccctcttgttgctagatttacaaagaaatccaaaggta |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2745500 |
atgtcaagctttgacattctcagtgtagtttccttcatcttcatctatcggagaattctcgaccctcttgttgctagatttacaaagaaatccaaaggta |
2745599 |
T |
 |
Q |
210 |
tcaccgagcttcaaaggatgggaataggtctagtattagcaatcatagcaatgg |
263 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2745600 |
tcaccgagcttcaaaggatgggaataggtctagtattagcaatcatagcaatgg |
2745653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2641 times since January 2019
Visitors: 6164