View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0854_low_59 (Length: 244)
Name: NF0854_low_59
Description: NF0854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0854_low_59 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 103 - 216
Target Start/End: Complemental strand, 42998074 - 42997961
Alignment:
Q |
103 |
aaatgttaaaatgaattatattatcaaaccaaaatgtctccaacacaagatgtgtttaagaagacataaagttatgaagttatccaatacaagaatgaag |
202 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42998074 |
aaatgctaaaatgaattatattatcaaaccaaaatgtctccaacacaagatgtgtttaagaagacataaagttatgaagttatccaatacaagaatgaag |
42997975 |
T |
 |
Q |
203 |
aaaatgaagcaaaa |
216 |
Q |
|
|
|||||||||||||| |
|
|
T |
42997974 |
aaaatgaagcaaaa |
42997961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 4155022 - 4154965
Alignment:
Q |
111 |
aaatgaattatattatcaaaccaaaatgtctccaacacaagatgtgtttaagaagaca |
168 |
Q |
|
|
||||||||||||||| |||||||||| |||| | ||||||||||||| |||||||| |
|
|
T |
4155022 |
aaatgaattatattagcaaaccaaaaggtcttcgctacaagatgtgtttcagaagaca |
4154965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University