View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0854_low_62 (Length: 228)
Name: NF0854_low_62
Description: NF0854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0854_low_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 7 - 215
Target Start/End: Complemental strand, 31366655 - 31366441
Alignment:
| Q |
7 |
acaatacatttttgttaaccaaagaagtggcatctgagagaagggatgaagaggttgatgaagacacagaagaacacttgtgattgttgttagt---nnn |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31366655 |
acaatacatttttgttaaccaaagaagtggcatctgagagaagggatgaggaggttgatgaagacacagaagaacacttgtgattgttgttagtatcatc |
31366556 |
T |
|
| Q |
104 |
nnnnnnnnnnnnnntgttgttgtt---aaagaagtcgtcaaaataggtagtccagccactctcctcagtagaatcagtaggagctttgcttatggaactc |
200 |
Q |
| |
|
||||| |||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31366555 |
atcatcatcatcattgttgctgttgttaaagaagtagtcaaaataggtagtccagccactctcctcagtagaatcagtaggagctttgcttatggaactc |
31366456 |
T |
|
| Q |
201 |
attaggtttttgagg |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31366455 |
attaggtttttgagg |
31366441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2084 times since January 2019
Visitors: 6156