View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0854_low_70 (Length: 202)

Name: NF0854_low_70
Description: NF0854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0854_low_70
NF0854_low_70
[»] chr6 (1 HSPs)
chr6 (1-123)||(13034565-13034686)


Alignment Details
Target: chr6 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 13034686 - 13034565
Alignment:
1 agttttgggacatgtacatataannnnnnnngtctaatatcgatcaaatcactatcttagacggtacaatgatttgtgaacttctacttagaagaacggt 100  Q
    |||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13034686 agttttgggacatgtacatataattttttt-gtctaatatcgatcaaatcactatcttagacggtacaatgatttgtgaacttctacttagaagaacggt 13034588  T
101 gtcggtaattgaataattatatt 123  Q
    |||||||||||||||||||||||    
13034587 gtcggtaattgaataattatatt 13034565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2700 times since January 2019
Visitors: 6165