View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0854_low_71 (Length: 201)

Name: NF0854_low_71
Description: NF0854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0854_low_71
NF0854_low_71
[»] chr6 (1 HSPs)
chr6 (1-122)||(13034565-13034686)


Alignment Details
Target: chr6 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 13034686 - 13034565
Alignment:
1 agttttgggacatgtacatataannnnnnngtctaatatcgatcaaatcactatcttagacggtacaatgatttgtgaacttctacttagaagaacggtg 100  Q
    |||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13034686 agttttgggacatgtacatataatttttttgtctaatatcgatcaaatcactatcttagacggtacaatgatttgtgaacttctacttagaagaacggtg 13034587  T
101 tcggtaattgaataattatatt 122  Q
    ||||||||||||||||||||||    
13034586 tcggtaattgaataattatatt 13034565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1597 times since January 2019
Visitors: 6145