View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0855_high_15 (Length: 316)
Name: NF0855_high_15
Description: NF0855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0855_high_15 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 96 - 316
Target Start/End: Original strand, 323268 - 323488
Alignment:
Q |
96 |
ggaataccttttgaggaagacatgtatttgttgggacatagcgtcctccttttccttggctttttcagcctgttagttagttgatgaaaaatgtttagac |
195 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
323268 |
ggaataccttttgaggaagccatgtatttgttgggacatagcgtcctccatttccttggctttttcagcctgttagttagttgatgaaaaatgtttagac |
323367 |
T |
 |
Q |
196 |
ttagacttgagaatatgaagaagttatttaaatgaaaag-caacctgacctaacctcaattattgcatgatccctttcagcaaaggcagtagctacacag |
294 |
Q |
|
|
|| |||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
T |
323368 |
tt-gacttgagaataagaagaagttatttaaatgaaaagaaaacctgacctaacctcaattattgcatgatccctttcagaaaaagcagtagctacacag |
323466 |
T |
 |
Q |
295 |
ccctggaaacacttaagctgct |
316 |
Q |
|
|
||||||||| | |||||||||| |
|
|
T |
323467 |
ccctggaaaaatttaagctgct |
323488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2439 times since January 2019
Visitors: 6162