View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0855_high_9 (Length: 348)
Name: NF0855_high_9
Description: NF0855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0855_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 30 - 337
Target Start/End: Original strand, 52071236 - 52071543
Alignment:
| Q |
30 |
ttggttgttactcattgaatcactatccctgctatcaacatgcattgatggctttgtttttgtctctgtctcaactttgttctgcaaattctgcattgtt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52071236 |
ttggttgttactcattgaatcactatccctgctatcaacatgcattgatggctttgtttttgtctctgtctcaactttgttctgcaaattctgcattgtt |
52071335 |
T |
|
| Q |
130 |
gatgagttagggagtgaattcatgaataataccttagagcacttggtagcttttgtacgaacaacatgtgagtttggcaccattggtttaggattgttct |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52071336 |
gatgagttagggagtgaattcatgaataataccttagagcacttggtagcttttgtacgaacaacatgtgagtttggcaccattggtttaggattgttct |
52071435 |
T |
|
| Q |
230 |
gtttatgtgcgatctttgcattttttggagtagagttgttggtgttttgttgttggagatctttaaccttttttcctaaattcgtgttccaataattctt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52071436 |
gtttatgtgcgatctttgcattttttggagtagagttgttggtgttttgttgttggagatctttaaccttttttcctaaattcgtgttccaataattctt |
52071535 |
T |
|
| Q |
330 |
gatttcat |
337 |
Q |
| |
|
|||||||| |
|
|
| T |
52071536 |
gatttcat |
52071543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2093 times since January 2019
Visitors: 6156