View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0855_low_13 (Length: 348)

Name: NF0855_low_13
Description: NF0855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0855_low_13
NF0855_low_13
[»] chr4 (1 HSPs)
chr4 (30-337)||(52071236-52071543)


Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 30 - 337
Target Start/End: Original strand, 52071236 - 52071543
Alignment:
30 ttggttgttactcattgaatcactatccctgctatcaacatgcattgatggctttgtttttgtctctgtctcaactttgttctgcaaattctgcattgtt 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52071236 ttggttgttactcattgaatcactatccctgctatcaacatgcattgatggctttgtttttgtctctgtctcaactttgttctgcaaattctgcattgtt 52071335  T
130 gatgagttagggagtgaattcatgaataataccttagagcacttggtagcttttgtacgaacaacatgtgagtttggcaccattggtttaggattgttct 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52071336 gatgagttagggagtgaattcatgaataataccttagagcacttggtagcttttgtacgaacaacatgtgagtttggcaccattggtttaggattgttct 52071435  T
230 gtttatgtgcgatctttgcattttttggagtagagttgttggtgttttgttgttggagatctttaaccttttttcctaaattcgtgttccaataattctt 329  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52071436 gtttatgtgcgatctttgcattttttggagtagagttgttggtgttttgttgttggagatctttaaccttttttcctaaattcgtgttccaataattctt 52071535  T
330 gatttcat 337  Q
    ||||||||    
52071536 gatttcat 52071543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University