View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0855_low_19 (Length: 324)
Name: NF0855_low_19
Description: NF0855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0855_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 310
Target Start/End: Complemental strand, 7832397 - 7832128
Alignment:
Q |
19 |
catttatcattccccacttttcaggtgatataagaaagaatagtactaggaatttgaatattgctcctcctagcgagagatgggtgtgtttttgggttgc |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
T |
7832397 |
catttatcattccccacttttcaggtgatataagaaagaagagtactaggaatttgaatattgctcctcctagcaagagatgggtgcgtttttgggttgc |
7832298 |
T |
 |
Q |
119 |
cgaggagcctttgggaataacctttgtatgttatggagatgcttccccaaaacctccctttgttcggtttgataatgttgggacaagagagtgtgaagtt |
218 |
Q |
|
|
||||||||||||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
7832297 |
cgaggagcctttgagaa----------------------tgcttccccaaaacctccctttgttcggattgataatgttgggacaagagagtgtgaagtt |
7832220 |
T |
 |
Q |
219 |
tgggttcccttttcagagtaagggatttgtattacttttgaaggaataaaaggttcctatgtttgaaatagtttcaaaaagattggtctctg |
310 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7832219 |
tgggttcccttttcagactaagggatttgtattacttttgaaggaataaaaggttcctatgtttgaaatagtttcaaaaagattggtctctg |
7832128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1592 times since January 2019
Visitors: 6145