View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0855_low_24 (Length: 314)
Name: NF0855_low_24
Description: NF0855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0855_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 30 - 286
Target Start/End: Complemental strand, 29773006 - 29772758
Alignment:
Q |
30 |
cttctaacataaaattcatctatctcatggccattgtatgttatgctaccagttttctgtaagaataacaaacaaacnnnnnnncagtaagaagatgatg |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
29773006 |
cttctaacataaaattcatctatctcatggccattgtaggttatgctaccagttttctgtaagaataacaaacaaacaaaaaaacagtaagaagatgatg |
29772907 |
T |
 |
Q |
130 |
ggtgagactaacctgtttagtacggaaactttcagattcaagggtgtcccgtgtatgatcacttccactatctcaaatctcaaattattacaatgtcaca |
229 |
Q |
|
|
|||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
29772906 |
ggtgagacatacctgtttagtacgcaaac-ttcagattcaagggtgtcccgtgtatgatcacttccact-------atctcaaattattacaatgtcaca |
29772815 |
T |
 |
Q |
230 |
tgtcagtgtcgtgtcccaatgtgcatgcttgatagagagtaacattctatcagatga |
286 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29772814 |
tgtcagtgtcgtgtcccaatgtgcatgcttgatagagagtaacattctatcagatga |
29772758 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University