View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0855_low_27 (Length: 291)
Name: NF0855_low_27
Description: NF0855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0855_low_27 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 54 - 291
Target Start/End: Complemental strand, 41001918 - 41001679
Alignment:
| Q |
54 |
ccctccaccagccacaaccttcccatgttatctccctatctaatctaataaccttaactcaagttcagatcagtggaagaggcaaccgagttctccaata |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41001918 |
ccctccaccagccacaaccttcccatgttatctccctatctaat--aataaccttaactcaagttcagatcagtggaagaggcaaccgagttctcaaata |
41001821 |
T |
|
| Q |
154 |
tatatagttatttcttgcattcatcttcgtatagtcatt----tcatcaaatattctagatattagcactccatggccgacgacaaaataccatcataat |
249 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41001820 |
tatatagttttttcttgcattcatcttcgtatagtcattggcttcatcaaatattctagatattagcactccatggccgacgacaaaataccatcatagt |
41001721 |
T |
|
| Q |
250 |
ccttgcaattggggaaaaatagataaaaactaaaccgttact |
291 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41001720 |
ccttgcaattggggaaaaataaataaaaactaaaccgttact |
41001679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1788 times since January 2019
Visitors: 6150