View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0855_low_35 (Length: 251)
Name: NF0855_low_35
Description: NF0855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0855_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 7450879 - 7450662
Alignment:
| Q |
16 |
atacacaagtactagtagctagttggaaaaataatgtgaagaaaaagccatcaagaaaagagacgagctttccattggaagacaaagcctaagctagtcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7450879 |
atacacaagtactagtagctagttggaaaaataatgtgaagaaaaagccatcaagaaaagagacgagctttccattggaagacaaagcctaagctagtcc |
7450780 |
T |
 |
| Q |
116 |
ctttcatcaaaaggttgaattaattattgcccatataaaagcaacaaatctccacagctaagtcagtatcttcgagaggcttgtatagaataatcaaaga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7450779 |
ctttcatcaaaaggttgaattaattattccccatataaaagcaacaaatctccacagctaagtcagtatcttcgagaggcttgtatagaataatcaaaga |
7450680 |
T |
 |
| Q |
216 |
ttcttgctacttgattta |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7450679 |
ttcttgctacttgattta |
7450662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 88 - 127
Target Start/End: Complemental strand, 7436794 - 7436755
Alignment:
| Q |
88 |
cattggaagacaaagcctaagctagtccctttcatcaaaa |
127 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
7436794 |
cattggaagacaaagccaaagctagtccctttcataaaaa |
7436755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University