View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0855_low_36 (Length: 243)
Name: NF0855_low_36
Description: NF0855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0855_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 52541976 - 52541752
Alignment:
| Q |
1 |
aacctggtggtaggaagagggatgagatttttgttgatgtgattgaaaaaataagtctcacattcaattccagtgtaagtatgcaggtttatctcttaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52541976 |
aacctggtggtaggaagagggatgagatttttgttgatgtgattgaaaaaataagtctcacattcaattccagtgtaagtatgcaggtttatctcttaca |
52541877 |
T |
|
| Q |
101 |
tgtttatgtcgtcatgcaatctattacactgtctttcctcccttcttattgctgcaaaattttgaagctttgtgatgagttgtattgtttacaacaggga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52541876 |
tgtttatgtcgtcatgcaatctattacactgtctttcctcccttcttattgctgcaaaattttgaagctttgtgatgagttgtattgtttacaacaggga |
52541777 |
T |
|
| Q |
201 |
tttatactcaccagtgagattgatg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52541776 |
tttatactcaccagtgagattgatg |
52541752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2809 times since January 2019
Visitors: 6167