View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0855_low_40 (Length: 225)
Name: NF0855_low_40
Description: NF0855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0855_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 140 - 211
Target Start/End: Complemental strand, 9439508 - 9439437
Alignment:
| Q |
140 |
gagggaatatctggtctaaaattcttttcaggtgaaccttcattaaattatccttgtgtagatctcattcat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| ||||| || |||| |||||||||||||| |
|
|
| T |
9439508 |
gagggaatatctggtctaaaattcttttcaggcgaaccttcatcaaattctcattgtatagatctcattcat |
9439437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University