View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0855_low_40 (Length: 225)

Name: NF0855_low_40
Description: NF0855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0855_low_40
NF0855_low_40
[»] chr3 (1 HSPs)
chr3 (140-211)||(9439437-9439508)


Alignment Details
Target: chr3 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 140 - 211
Target Start/End: Complemental strand, 9439508 - 9439437
Alignment:
140 gagggaatatctggtctaaaattcttttcaggtgaaccttcattaaattatccttgtgtagatctcattcat 211  Q
    |||||||||||||||||||||||||||||||| |||||||||| ||||| || |||| ||||||||||||||    
9439508 gagggaatatctggtctaaaattcttttcaggcgaaccttcatcaaattctcattgtatagatctcattcat 9439437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University