View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_100 (Length: 322)
Name: NF0856_high_100
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_high_100 |
 |  |
|
[»] scaffold0262 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 1e-50; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 149 - 271
Target Start/End: Complemental strand, 43100767 - 43100643
Alignment:
Q |
149 |
gctctgttgtggatgatctt--aaggtgtgtttgatcgtgttgtaggagaattaatttctgttaaatgtaattttgatcgtaagtgatttatcattggtt |
246 |
Q |
|
|
||||||||||||||| |||| |||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43100767 |
gctctgttgtggatggtcttttaaggtgtgtttgatcgcgatgtaggagaattaatttctgttaaatgtaattttgatcgtaagtgatttatcattggtt |
43100668 |
T |
 |
Q |
247 |
gggcagagccagaaatttagcattg |
271 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
43100667 |
gggcagagccagaaatttagcattg |
43100643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 254 - 311
Target Start/End: Complemental strand, 43100637 - 43100580
Alignment:
Q |
254 |
gccagaaatttagcattggtggtgcctagtccattgaatataatttgcagccagaatt |
311 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43100637 |
gccagaaatttagcattggtggtgcctagtccattgaatataatttgcagccagaatt |
43100580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 108
Target Start/End: Complemental strand, 43100846 - 43100769
Alignment:
Q |
30 |
atagggttatttgtgggcctagttagtaannnnnnnngaggtaatgagttggagaaaattgatgtttatcaaatattac |
108 |
Q |
|
|
||||||||||||||||||||||||| ||| |||| ||||||||||||||||||| |||||||||| |||||| |
|
|
T |
43100846 |
atagggttatttgtgggcctagttaataatttcttttgagg-aatgagttggagaaaattggtgtttatcaagtattac |
43100769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 109 - 153
Target Start/End: Complemental strand, 9622180 - 9622136
Alignment:
Q |
109 |
tgtggacataggggacccacttaagcacccaatatgggatgctct |
153 |
Q |
|
|
||||||||||| |||||||||||| |||||||| || |||||||| |
|
|
T |
9622180 |
tgtggacatagtggacccacttaaacacccaatgtgagatgctct |
9622136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 8845846 - 8845903
Alignment:
Q |
109 |
tgtggacataggggacccacttaagcacccaatatgggatgctctgttgtggatgatc |
166 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
T |
8845846 |
tgtggacataggagacccacttaagcacccaatatggggtgctctattgtggatgatc |
8845903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 123 - 167
Target Start/End: Complemental strand, 43417701 - 43417657
Alignment:
Q |
123 |
acccacttaagcacccaatatgggatgctctgttgtggatgatct |
167 |
Q |
|
|
||||| ||||||||||||| || | |||||||||||||||||||| |
|
|
T |
43417701 |
acccatttaagcacccaatttgaggtgctctgttgtggatgatct |
43417657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 37182433 - 37182372
Alignment:
Q |
109 |
tgtggacataggggacccacttaagcacccaatatgggatgctctgttgtggatgatcttaa |
170 |
Q |
|
|
|||||||||||||||| |||||||||||||||| |||| |||||| |||||||||||||||| |
|
|
T |
37182433 |
tgtggacataggggactcacttaagcacccaatgtggggtgctctcttgtggatgatcttaa |
37182372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 109 - 169
Target Start/End: Original strand, 37997183 - 37997243
Alignment:
Q |
109 |
tgtggacataggggacccacttaagcacccaatatgggatgctctgttgtggatgatctta |
169 |
Q |
|
|
||||||||||| |||||| |||| ||||||||||||| |||||||||||||||| ||||| |
|
|
T |
37997183 |
tgtggacatagatgacccatttaaacacccaatatggggtgctctgttgtggatggtctta |
37997243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 129 - 171
Target Start/End: Complemental strand, 12832284 - 12832242
Alignment:
Q |
129 |
ttaagcacccaatatgggatgctctgttgtggatgatcttaag |
171 |
Q |
|
|
||||||||||||| | ||||||||||||||||||| ||||||| |
|
|
T |
12832284 |
ttaagcacccaatttaggatgctctgttgtggatggtcttaag |
12832242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 109 - 162
Target Start/End: Complemental strand, 25742407 - 25742354
Alignment:
Q |
109 |
tgtggacataggggacccacttaagcacccaatatgggatgctctgttgtggat |
162 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||| ||||||||||||||| |
|
|
T |
25742407 |
tgtggacatagaggaccaacttaagcacccaatgtggggtgctctgttgtggat |
25742354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 109 - 169
Target Start/End: Complemental strand, 19554743 - 19554683
Alignment:
Q |
109 |
tgtggacataggggacccacttaagcacccaatatgggatgctctgttgtggatgatctta |
169 |
Q |
|
|
|||| |||||| ||| |||||||||||||||| |||| |||| ||||||||||||||||| |
|
|
T |
19554743 |
tgtgaacatagatgactcacttaagcacccaatgtggggtgctgtgttgtggatgatctta |
19554683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 163
Target Start/End: Original strand, 37333452 - 37333506
Alignment:
Q |
109 |
tgtggacataggggacccacttaagcacccaatatgggatgctctgttgtggatg |
163 |
Q |
|
|
|||||||||||||| |||||||||||| |||||||| ||||||||||| |||| |
|
|
T |
37333452 |
tgtggacatagggggttcacttaagcacctaatatggggtgctctgttgtagatg |
37333506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 109 - 168
Target Start/End: Complemental strand, 1695 - 1636
Alignment:
Q |
109 |
tgtggacataggggacccacttaagcacccaatatgggatgctctgttgtggatgatctt |
168 |
Q |
|
|
|||||| ||||||||| |||||||||||||||| | | ||||| ||||||||||||||| |
|
|
T |
1695 |
tgtggatataggggactcacttaagcacccaatgtcaggtgctcggttgtggatgatctt |
1636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2878 times since January 2019
Visitors: 6167