View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0856_high_103 (Length: 316)

Name: NF0856_high_103
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0856_high_103
NF0856_high_103
[»] chr7 (1 HSPs)
chr7 (13-316)||(27640305-27640608)
[»] chr2 (1 HSPs)
chr2 (235-269)||(1032039-1032073)


Alignment Details
Target: chr7 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 13 - 316
Target Start/End: Original strand, 27640305 - 27640608
Alignment:
13 gagaagctgttttgggagatgccgcataggaatgtggtgtcgtggactgttatgattggtgggttgttgaaggaatcgcgtattgatgatgcgaagaaac 112  Q
    ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27640305 gagaagctgttttgggagatgccacgtaggaatgtggtgtcgtggactgttatgattggtgggttgttgaaggaatcgcgtattgatgatgcgaagaaac 27640404  T
113 tgtttgatatgataccggagaaggatgttgtggtggttactaatatgattggtgggtattgtcaggtgggtcgtttggatgaagctcgcgaactgtttga 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27640405 tgtttgatatgataccggagaaggatgttgtggtggttactaatatgattggtgggtattgtcaggtgggtcgtttggatgaagctcgcgaactgtttga 27640504  T
213 tgaaatgaaggtgaggaatgtgtttacttggactactatggtttctgggtatgcaaagaatgggagggttgatgttgcaaggaagctttttgaggtgatg 312  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27640505 tgaaatgaaggtgaggaatgtgtttacttggactactatggtttctgggtatgcaaagaatgggagggttgatgttgcaaggaagctttttgaggtgatg 27640604  T
313 ccgg 316  Q
    ||||    
27640605 ccgg 27640608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 269
Target Start/End: Complemental strand, 1032073 - 1032039
Alignment:
235 tttacttggactactatggtttctgggtatgcaaa 269  Q
    ||||||||||||||||||||| |||||||||||||    
1032073 tttacttggactactatggttgctgggtatgcaaa 1032039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University