View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_112 (Length: 304)
Name: NF0856_high_112
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_high_112 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 29 - 293
Target Start/End: Complemental strand, 38613778 - 38613514
Alignment:
Q |
29 |
aaagaagaaggtccagagccaagtagtttttgagcgagataatgcatacgcatcaagaccaagcaccagcagtagacgccttccaaatagaagcttaaat |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38613778 |
aaagaagaaggtccagagccaagtagtttttgagcgagataatgcatacgcatcaagaccaagcaccagcagtagacgccttccaaatagaagcttaaat |
38613679 |
T |
 |
Q |
129 |
ggaagtctagattattctccacccatgaacaaaaggctcccaatgggtatccaacaactgggatcaaacaacataaattcaggaaatcaaggtgtatcct |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
38613678 |
ggaagtctagattattctccacccatgaacaaaaggctcccaatgggtatccaacaactgggatcaaacaacataaattcaggaaatcaaggtatatcct |
38613579 |
T |
 |
Q |
229 |
tcattaaggatggaaggaagatacagaggaaaaagatttttgacgaacctacctttacgtttcat |
293 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38613578 |
tcattaaggatggaaggaagatacagaggaaaaagatttttgacgaacctacctttacgtttcat |
38613514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University