View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_117 (Length: 295)
Name: NF0856_high_117
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_high_117 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 119 - 295
Target Start/End: Complemental strand, 28668226 - 28668050
Alignment:
| Q |
119 |
aatcccttcaccttacataaattccttttaccatataatctgtactaaccagcaaacattcccaaaatgaactattcctcagatacacttcaaatcaata |
218 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28668226 |
aatctcttcaccctacataaattccttttaccatataatctgtactaaccagcaaacattcccaaaatgaactattcctcagatacacttcaaatcaata |
28668127 |
T |
|
| Q |
219 |
cccaacttgcaaacatttcaggtcaccaaatcaaaccacttatgcaaaatcaaccacgccaagaaaacatacctcat |
295 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28668126 |
cccaatttgcaaacatttcaggtcaccaaatcaaaccacttatgcaaaatcaaccacgccaagaaaacatacctcat |
28668050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2842 times since January 2019
Visitors: 6167