View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_125 (Length: 292)
Name: NF0856_high_125
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_high_125 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 109 - 174
Target Start/End: Complemental strand, 2313552 - 2313487
Alignment:
Q |
109 |
tgtagtattcattgtttagagttttatacagttgtttacaagagccttcaaacactaaaatgtgga |
174 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
2313552 |
tgtagtattcattatttagagttttatacagttgtttacaagagccttcaaacactataatgtgga |
2313487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 72 - 119
Target Start/End: Complemental strand, 2313648 - 2313601
Alignment:
Q |
72 |
aagaaaagaaactactaccggttactaagatgtaagttgtagtattca |
119 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
2313648 |
aagaaaagaaactactactggttactaagatgtaagttgtagtattca |
2313601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University