View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0856_high_125 (Length: 292)

Name: NF0856_high_125
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0856_high_125
NF0856_high_125
[»] chr4 (2 HSPs)
chr4 (109-174)||(2313487-2313552)
chr4 (72-119)||(2313601-2313648)


Alignment Details
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 109 - 174
Target Start/End: Complemental strand, 2313552 - 2313487
Alignment:
109 tgtagtattcattgtttagagttttatacagttgtttacaagagccttcaaacactaaaatgtgga 174  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||    
2313552 tgtagtattcattatttagagttttatacagttgtttacaagagccttcaaacactataatgtgga 2313487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 72 - 119
Target Start/End: Complemental strand, 2313648 - 2313601
Alignment:
72 aagaaaagaaactactaccggttactaagatgtaagttgtagtattca 119  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||    
2313648 aagaaaagaaactactactggttactaagatgtaagttgtagtattca 2313601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University