View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_13 (Length: 622)
Name: NF0856_high_13
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_high_13 |
 |  |
|
[»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 316; Significance: 1e-178; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 255 - 622
Target Start/End: Original strand, 13461419 - 13461786
Alignment:
Q |
255 |
caagtaaaatggtatgattttatcttcagatctaaaaccttttgcattacacatagttttaaatgctatattactaatgaataggattcctacaaagcta |
354 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
13461419 |
caagtaaaatggtatgattttatcttcagatctaaaaccttttgcattacacatagttttaaatgctatattactgatgaataggattcctacaaagcta |
13461518 |
T |
 |
Q |
355 |
ttcaaaaacaagtcttctgatgagatactatatggtcaaattcttggccacggtcaattaaaggtttttagttgtttgagtgatgttactaccttaccaa |
454 |
Q |
|
|
||| ||||||||| |||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
T |
13461519 |
ttccaaaacaagtgttcttatgagatactatatggtcaaatgcttggccacggtcaattaaaggtttttggttgtttgagtgatgtttctaccttaccaa |
13461618 |
T |
 |
Q |
455 |
ctaatatagacataaacatagcctttgctgctcaacggttgagtcatttatatgaacaaacatagcctttgctgctcaacggttgagtcatttatatgaa |
554 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
13461619 |
ctaatatagacataaacatagcctttgctgctcaacggttgagtcatttatatgaacaaacatagccgttgctgctcaacggttgagtcatttatatgaa |
13461718 |
T |
 |
Q |
555 |
caaacatagcctttgctgctcaacggttgagtcatttatatgaacaaacatagcctttgctgctcaac |
622 |
Q |
|
|
|| |||||||||||||||||||| ||||||||| |||||||||||| |||||||| |||||||||||| |
|
|
T |
13461719 |
cagacatagcctttgctgctcaatggttgagtcttttatatgaacagacatagccattgctgctcaac |
13461786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 113; E-Value: 7e-57
Query Start/End: Original strand, 468 - 612
Target Start/End: Original strand, 13461676 - 13461820
Alignment:
Q |
468 |
aaacatagcctttgctgctcaacggttgagtcatttatatgaacaaacatagcctttgctgctcaacggttgagtcatttatatgaacaaacatagcctt |
567 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||| |||||||| | |
|
|
T |
13461676 |
aaacatagccgttgctgctcaacggttgagtcatttatatgaacagacatagcctttgctgctcaatggttgagtcttttatatgaacagacatagccat |
13461775 |
T |
 |
Q |
568 |
tgctgctcaacggttgagtcatttatatgaacaaacatagccttt |
612 |
Q |
|
|
||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
T |
13461776 |
tgctgctcaacggttgagtcatttatatgaatagacatagccttt |
13461820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 470 - 587
Target Start/End: Original strand, 13461722 - 13461839
Alignment:
Q |
470 |
acatagcctttgctgctcaacggttgagtcatttatatgaacaaacatagcctttgctgctcaacggttgagtcatttatatgaacaaacatagcctttg |
569 |
Q |
|
|
|||||||||||||||||||| ||||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
T |
13461722 |
acatagcctttgctgctcaatggttgagtcttttatatgaacagacatagccattgctgctcaacggttgagtcatttatatgaatagacatagcctttt |
13461821 |
T |
 |
Q |
570 |
ctgctcaacggttgagtc |
587 |
Q |
|
|
|||||| ||||||||| |
|
|
T |
13461822 |
tagctcaatggttgagtc |
13461839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3525 times since January 2019
Visitors: 6174