View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_152 (Length: 264)
Name: NF0856_high_152
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_high_152 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 54 - 202
Target Start/End: Original strand, 32750136 - 32750284
Alignment:
Q |
54 |
atgaggttgctaagagaaaacattagcacttgtttgatcaaactcaaactatattattccaaaataaggttctcgaaaaagcttaggaaggcagttttag |
153 |
Q |
|
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32750136 |
atgaggttgctaagagaaaaaatgggcacttgtttgatcaaactcaaactatattatttcaaaataaggttctcgaaaaagcttaggaaggcagttttag |
32750235 |
T |
 |
Q |
154 |
ctgcatcttatctcataagtcatttgccttctagtgtcttaattccaaa |
202 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
32750236 |
ctgcatcttatctcataaatcatttgccttctagtgtcttaattccaaa |
32750284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 58 - 125
Target Start/End: Original strand, 50058786 - 50058853
Alignment:
Q |
58 |
ggttgctaagagaaaacattagcacttgtttgatcaaactcaaactatattattccaaaataaggttc |
125 |
Q |
|
|
||||||| |||||||| || ||| ||||| |||||||||| | |||| ||||||||||||||||||| |
|
|
T |
50058786 |
ggttgctgagagaaaaaatgggcatttgttagatcaaactcgagctatgttattccaaaataaggttc |
50058853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2637 times since January 2019
Visitors: 6164